Επικαιροτητα

Πανελλαδικές Εξετάσεις 2022: Οι Απαντήσεις Στη Βιολογία Προσανατολισμού

Mια συνεργασία του ilioupolinews.gr σε συνεργασία με τον Εκπαιδευτικό Οργανισμό «Ρόμβος» για τις πανελλαδικές εξετάσεις του 2022.

Δημοσιεύθηκε στις | Τελευταία Ενημέρωση

Συντάκτης ilioupolinews.gr

Πανελλαδικές Εξετάσεις 2022: Οι Απαντήσεις Στη Βιολογία Προσανατολισμού

Στο δεύτερο πανελλαδικώς εξεταζόμενο μάθημα εξετάστηκαν οι υποψήφιοι σήμερα 6/6/2022. Το ilioupolinews.gr σε συνεργασία με την αλυσίδα φροντιστηρίων «Ρόμβος», δημοσιεύουν τις απαντήσεις για το μάθημα της βιολογίας προσανατολισμού.

Σύμφωνα με τους διδάσκοντες του εκπαιδευτικού οργανισμού Ρόμβος «Τα θέματα απαιτούσαν συνδυαστική σκέψη, παρατηρητικότητα, εμβάθυνση στην ύλη και πλήρη κατανόηση των βιολογικών εννοιών και μηχανισμών που πραγματεύεται το σχολικό βιβλίο».

Aκολουθούν οι απαντήσεις:


ΘΕΜΑ Α

Α1. Γ

Α2. Β

Α3. Α

Α4. Γ

Α5. Δ

ΘΕΜΑ Β

Β1. 1. Στ , 2. Ε , 3. Α , 4. Γ, 5. Δ

Β2. Κύτταρο Α : πραγματοποιεί μίτωση, Κύτταρο Β: πραγματοποιεί μείωση

Στο πρώτο διάγραμμα φαίνεται ότι η ποσότητα DNA στα θυγατρικά κύτταρα είναι ίδια με την ποσότητα DNA στο αρχικό (μητρικό) κύτταρο (α). Η μίτωση είναι τύπος κυτταρικής διαίρεσης που υφίστανται τα σωματικά κύτταρα ενός πολυκύτταρου οργανισμού προκειμένου να δημιουργηθούν γενετικά πανομοιότυπα κύτταρα με το μητρικό.

Στο δεύτερο διάγραμμα φαίνεται ότι η ποσότητα DNA στα θυγατρικά κύτταρα (α/2) είναι η μισή από την ποσότητα DNA του μητρικού (α). Τα θυγατρικά κύτταρα είναι γαμέτες και το μητρικό, άωρο γεννητικό κύτταρο.

Τύπος κυτταρικής διαίρεσης που εξασφαλίζει γενετική σταθερότητα: μίτωση

Τύπος κυτταρικής διαίρεσης που εξασφαλίζει γενετική ποικιλομορφία: μείωση

Β3. Α. Σελ. 123 σχολικού βιβλίου, τεύχος Β: «…τα Β-λεμφοκύτταρα δεν επιβιώνουν … μονοκλωνικού αντισώματος.»

Β. Σελ. 25 σχολικού βιβλίου, τεύχος Α «Η τρισδιάστατη δομή μίας πρωτεΐνης καθορίζει… (αλβουμίνη) μετουσιώνεται.»

Β4. Η πιστότητα της αντιγραφής εξασφαλίζεται:

1. Λόγω της δομής του DNA στο χώρο (μοντέλο της διπλής έλικας): σελ. 20-21 σχολικού βιβλίου, τεύχος Β «Οι 2 αλυσίδες του μορίου … πανομοιότυπα με το μητρικό μόριο.»

2. Με τον ημισυντηρητικό μηχανισμό αντιγραφής. Σελ. 31 σχολ. Βιβλίου τεύχος Β, «Οι Watson και Crick φαντάστηκαν … ημισυντηρητικός.»  (η ανάλυση επικαλύπτεται με τον 1ο λόγο)

3. σελ. 31 σχολ. Βιβλίου τεύχος Β, «Τα κύτταρα διαθέτουν ένα σημαντικό ‘οπλοστάσιο’…εκπληκτική ακρίβεια.»

4. Λόγω της επιδιόρθωσης των λαθών της αντιγραφής, σελ. 32-33 σχολ. Βιβλίου τεύχος Β «DNA πολυμεράσες επιδιορθώνουν … τα σωστά,» και «Όπως τα προϊόντα ενός εργοστασίου … στο ένα στα 1010

Β5. Σελ. 23 σχολ. Βιβλίου τεύχος Α: «…διακρίνουμε τέσσερα επίπεδα οργάνωσης … και σταθεροποιείται από τους δεσμούς που σχηματίζονται ανάμεσα στις ομάδες R των αμινοξέων.»

Σελ. 25 σχολ. Βιβλίου τεύχος Α: «Είναι δικαιολογημένο να αναρωτιόμαστε … μίας πρωτεΐνης καθορίζει τη λειτουργία που αυτή εκτελεί.»

ΘΕΜΑ Γ

Γ1. Κατά τη δημιουργία της γονιδιωματικής βιβλιοθήκης και την επιλογή των μετασχηματισμένων βακτηρίων, είναι απαραίτητο τα μετασχηματισμένα και τα μη μετασχηματισμένα βακτήρια να μην έχουν ανθεκτικότητα στα ίδια αντιβιοτικά.

Άρα οι ενδεικνυόμενοι συνδυασμοί είναι:

Βακτήριο Α και πλασμίδιο 2, ώστε με προσθήκη καναμυκίνης τα μη μετασχηματισμένα βακτήρια να θανατώνονται.

Βακτήριο Β και πλασμίδιο 1, ώστε με προσθήκη αμπικιλίνης τα μη μετασχηματισμένα βακτήρια να θανατώνονται.

Βακτήριο Β και πλασμίδιο 3 ώστε με προσθήκη στρεπτομυκίνης,  τα μη μετασχηματισμένα βακτήρια να θανατώνονται.

Βακτήριο Β και πλασμίδιο 4, ώστε με προσθήκη συνδυασμού αμπικιλίνης και στρεπτομυκίνης τα μη μετασχηματισμένα βακτήρια να θανατώνονται.

Βακτήριο Γ και πλασμίδιο 4, ώστε με προσθήκη στρεπτομυκίνης τα μη μετασχηματισμένα βακτήρια να θανατώνονται.

Βακτήριο Γ και πλασμίδιο 3, ώστε με προσθήκη στρεπτομυκίνης τα μη μετασχηματισμένα βακτήρια να θανατώνονται.

Γ2. Ο τύπος κληρονομικότητας της β-θαλασσαιμίας είναι γνωστός, δηλαδή αυτοσωμικός υπολειπόμενος, όπως επιβεβαιώνεται από το γενεαλογικό δέντρο. Η ασθένεια ελέγχεται από πολλαπλά αλληλόμορφα γονίδια (πάνω από 300), εδώ όμως έχουμε το φυσιολογικό αλληλόμορφο Β και 2 από τα μεταλλαγμένα β1 και β2.

Το φυσιολογικό αλληλόμορφο Β δεν κόβεται από καμία Π.Ε., άρα έχει μήκος 500 ζ.β.

Η Π.Ε. Ε1 κόβει το β1 σε δύο θραύσματα. Η Π.Ε. Ε2 κόβει το β2 σε δύο θραύσματα.

Παρατηρούμε ότι το άτομο Ι2 που πάσχει έχει 2 αλληλόμορφα, που κόβονται από την Ε1 σε 100 και 400 ζ.β. Αφού δεν κόβονται από την Ε2, ο γονότυπος του ατόμου Ι2 είναι β1β1.

Παρατηρούμε ότι το άτομο ΙΙ4 που πάσχει έχει 2 αλληλόμορφα που κόβονται από την Ε2 σε 200 και 300 ζ.β. Αφού δεν κόβονται από την Ε1, ο γονότυπος του ΙΙ4 είναι β2β2.

Γ3. Γονότυποι ατόμων:

Ι1: ΒΒ

Ι2: β1β1

Ι3: Ββ2

Ι4: Ββ2

(οι Ι3 και Ι4 αποκτούν το ΙΙ4 άρα είναι φορείς)

ΙΙ1: Ββ1

ΙΙ2: Ββ1

ΙΙ3: Ββ2

ΙΙ4: β2β2

ΙΙΙ3: β1β2

Ο γονότυπος του ΙΙΙ3 επιβεβαιώνεται και από τον πίνακα Γ όπου φαίνεται ότι το γονίδιο β1 κόβεται με την Ε1 σε 100 και 400 ζ.β., αλλά όχι με την Ε2 (500 ζ.β.) και το γονίδιο β2 κόβεται με την Ε2 σε 200 και 300 ζ.β. αλλά όχι με την Ε1 (500 ζ.β.).

Γ4. Ο γονότυπος του ατόμου ΙΙ3 είναι Ββ2. Το γονίδιο Β θα δώσει 1 κομμάτι μήκους 500 ζ.β. αφού δεν κόβεται ούτε από την Ε1 ούτε από την Ε2. Το γονίδιο β2 κόβεται από την Ε2 σε 2 θραύσματα 200 ζ.β. και 300 ζ.β αλλά δεν κόβεται από την Ε1. Άρα θα προκύψουν 3 διαφορετικά κομμάτια μήκους 500 ζ.β., 300 ζ.β. και 200 ζ.β.

Γ5. [Προαιρετικά διασταυρώσεις που επιβεβαιώνουν τους γονότυπους των ατόμων του γενεαλογικού δέντρου:

1η

P:            ΒΒ x β1β1

Γαμέτες: Β        β1

F1:                 Bβ1

2η

P:            Ββ2 x Ββ2

Γαμέτες: Β  β2 ,   Β  β2

F1: BB   Bβ2   Ββ2   β2β2 ]

3η

P:                (ΙΙ2) Ββ1     x    (ΙΙ3) Ββ2

Γαμέτες:   Β  β1 ,   Β  β2

F1 : BB  Bβ1  Ββ2 β1β2

Κάθε κύηση είναι ανεξάρτητο γεγονός και δεν επηρεάζεται από το αποτέλεσμα προηγούμενων κυήσεων. Η γονοτυπική αναλογία της τρίτης διασταύρωσης είναι: 

1 ΒΒ: 1Ββ1 : 1Ββ2: 1β1β2

Συνεπώς η πιθανότητα ένας απόγονος να φέρει το β2 είναι ½.

Τα παραπάνω στηρίζονται στον 1ο νόμο του Mendel, σελ. 75 σχολικού βιβλίου τεύχος Β: «Ο τρόπος με τον οποίο … αλληλόμορφων γονιδίων.»

ΘΕΜΑ Δ

Δ1. Α. αλυσίδα ΙΙ: αντιστοιχεί στο cDNA

Aλυσίδα Ι: αντιστοιχεί στην αλυσίδα του γονιδίου

Β. Η αλυσίδα Ι είναι η κωδική αλυσίδα του γονιδίου. Αιτιολόγηση: Η κωδική αλυσίδα του γονιδίου είναι συμπληρωματική και αντιπαράλληλη με την μη κωδική. Το mRNA είναι συμπληρωματικό και αντιπαράλληλο με την μη κωδική. Το cDNA είναι συμπληρωματικό και αντιπαράλληλο με το mRNA. Άρα με την αντίστροφη μεταγραφή συντίθεται στην ουσία η μη κωδική αλυσίδα του γονιδίου (χωρίς εσώνια) δηλαδή cDNA = μη κωδική χωρίς εσώνια.

Έτσι το cDNA (μη κωδική) (ΙΙ) είναι συμπληρωματικό και αντιπαράλληλο με την κωδική (Ι).

Γ. Αντιπροσωπεύουν 2 εσώνια του γονιδίου δηλαδή ενδιάμεσες αλληλουχίες που μεταγράφονται αλλά δε μεταφράζονται σε αμινοξέα. Επειδή το cDNA συντίθεται από ώριμο mRNA, από το οποίο έχουν αποκοπεί τα εσώνια κατά τη διαδικασία της ωρίμανσης, όταν θα υβριδοποιηθεί το cDNA με την κωδική αλυσίδα του γονιδίου στην οποία υπάρχουν τα 2 εσώνια, αυτά θα δημιουργήσουν ‘θηλιές’ που δεν υβριδοποιούνται.

Δ2. Συμβολισμός γονιδίων:

ΧΑ : φυσιολογικό φυλοσύνδετο επικρατές αλληλόμορφο

Χα : υπολειπόμενο φυλοσύνδετο υπεύθυνο γονίδιο για την ασθένεια

Γονότυπος πατέρα: ΧΑΥ

Γονότυπος μητέρας: ΧΑΧα. Θεωρούμε τη μητέρα φορέα δηλαδή ότι φέρει το μεταλλαγμένο αλληλόμορφο.

Παρατηρούμε από τη διασταύρωση τους ότι δε μπορούν να αποκτήσουν κόρη που πάσχει με φυσιολογικό καρυότυπο.

P:                 ΧΑΧα       x      ΧΑΥ

Γαμέτες:   ΧΑ      Χα,    ΧΑ      Υ

F1: ΧΑΧα      ΧΑΧΑ     ΧΑΥ      ΧαΥ

Άρα εξετάζουμε περιπτώσεις μεταλλάξεων:

1ος  μηχανισμός: Γονιμοποίηση ωαρίου με 2 χρωμοσώματα ΧαΧα με σπερματοζωάριο χωρίς φυλετικό χρωμόσωμα (0).

Το ωάριο (ΧαΧα) μπορεί να προκύψει από μη διαχωρισμό των αδερφών χρωματίδων του Χα στη μείωση 2, σε άωρο γεννητικό κύτταρο της μητέρας οπότε προκύπτει ωάριο με τα 2 φυλετικά χρωμοσώματα ΧαΧα

Το σπερματοζωάριο (0) προκύπτει από μη διαχωρισμό είτε των φυλετικών χρωμοσωμάτων ΧΑΥ σε άωρο γεννητικό κύτταρο του πατέρα στη μείωση 1 είτε των αδερφών χρωματίδων του ΧΑ ή του Υ χρωμοσώματος στη μείωση 2.

Έτσι δημιουργείται ζυγωτό με 44 αυτοσωμικά χρωμοσώματα και 2 φυλετικά χρωμοσώματα ΧαΧα (μόνο μητρικής προέλευσης) δηλαδή φυσιολογικό αριθμό χρωμοσωμάτων.

2ος μηχανισμός: σε σπερματοζωάριο (ή σε άωρο γεννητικό κύτταρο) του πατέρα έγινε γονιδιακή επιβλαβής μετάλλαξη στο χρωμόσωμα Χ, στο γονίδιο Α που το κατέστησε ανενεργό (πχ. Αντικατάσταση, προσθήκη ή έλλειψη βάσεων) και το μετέτρεψε σε Χα . Γονιμοποίηση τέτοιου σπερματοζωαρίου με ωάριο της μητέρας που έχει το Χα δίνει κόρη ΧαΧα και φυσιολογικό αριθμό χρωμοσωμάτων. (άλλοι ενδεικτικοί μηχανισμοί: έλλειψη στο Xα του πατέρα (Χ) ή μετατόπιση ή αναστροφή δηλαδή δομικές χρωμοσωμικές ανωμαλίες που ‘αφαιρούν τη δράση’ του φυσιολογικού γονιδίου).

Δ5.

Α. Με βάση τον γενετικό κώδικα τα πιθανά κωδικόνια της φυσιολογικής πρωτεϊνης είναι:

Φυσιολογική πρωτεΐνη: NH2 – met – his – arg – leu – trp – gly – asp – …

Κωδικόνια:                   5’ … AUG  CAU CGU CUU UGG GGU GAU ..3’

                                                       CAC  CGU CUC          GGC  GAC

                                                              CGA CUA          GGA

                                                            CGG CUG           GGG

                                                            AGA UUA

                                                            AGG UUG

Μεταλλαγμένη πρωτεΐνη Α :

Παρατηρούμε αλλαγή μόνο του 4ου αμινοξέος, από leu σε trp. Συνεπώς το κωδικόνιο της leu είναι 5΄UUG3΄ και έγινε αντικατάσταση μίας βάσης:

Η 2η βάση Τ της κωδικής αλυσίδας του γονιδίου αντικαταστάθηκε από G και στη μη κωδική η Α από την C , που οδήγησε στο κωδικόνιο 5΄ UGG 3΄ της trp.

Mεταλλαγμένη πρωτεΐνη Β:

Παρατηρούμε πρόωρο τερματισμό της σύνθεσης της πολυπεπτιδικής αλυσίδας και δημιουργείται πενταπεπτίδιο. Άρα το κωδικόνιο της gly μεττράπηκε σε κωδικόνιο λήξης. Αυτό μπορεί να συμβεί με αντικατάσταση της 1ης βάσης του κωδικονίου της gly 5’GGA3’ G από Τ στην κωδική και C από Α στη μη κωδική αλυσίδα που οδήγησε σε κωδικόνιο λήξης 5’UGA3’

Μεταλλαγμένη πρωτεΐνη Γ: παρατηρούμε αλλαγή όλων των αμινοξέων από την met και μετά, άρα πρόκειται για αλλαγή στη ‘διαδρομή τριπλέτας’ (αναγνωστικό πλαίσιο).

Μεταλλαγμένη πρωτεΐνη Γ: NH2 – met – thr – gly – cys – gly – glu – thr – ..

Κωδικόνια :                            5’ AUG ACU GGU UGU GGU GAA ACU

                                                           ACC GGC UGC GGC GAG ACC

                                                          ACA GGA           GGA          ACA

                                                          ACG GGG           GGG         ACG

Έγινε έλλειψη της 1ης βάσης C του 2ου κωδικονίου της arg στην κωδική και συνεπώς της G στη μη κωδική. Έτσι μετατοπίστηκε το πλαίσιο ανάγνωσης και προέκυψαν τα κωδικόνια της μεταλλαγμένης Γ αλυσίδας.

Μεταλλαγμένη πρωτεΐνη Δ

Παρατηρούμε αλλαγή της αλληλουχίας των αμινοξέων μετά την his.

Μεταλλαγμένη πρωτεΐνη Δ : NH2 – met – his – met – trp – leu – trp – gly – asp …

Κωδικόνια        :                          5’  AUG CAU AUG UGG CUU UGG GGU GAU

                                                            CAC                      CUC           GGC  GAC

                                                                                        CUA           GGA

                                                                                        CUG           GGG

                                                                                        UUA

                                                                                        UUG

Πρόκειται για προσθήκη 3 βάσεων 5’TGT3’ εντός του κωδικονίου της arg στην κωδική (και 3’ACA5’ στη μη κωδική) δηλαδή 5’AGG3’ έγινε 5’ATGTGG3’

Β. 5’ATGCACAGGTTGTGGGGAGAC3’

Σχολιασμός Απαντήσεων

Τα θέματα απαιτούσαν συνδυαστική σκέψη, παρατηρητικότητα, εμβάθυνση στην ύλη και πλήρη κατανόηση των βιολογικών εννοιών και μηχανισμών που πραγματεύεται το σχολικό βιβλίο.

Επιμέλεια Απαντήσεων:

Ηρώ Παπαδάκη, Ευγενία Οικονομίδου

Ακολουθήστε το Ilioupolinews.gr στο Facebook και στο Google News για να μαθαίνετε πρώτοι τα τελευταία νέα από την Ηλιούπολη.

Αφήστε μια απάντηση

Η ηλ. διεύθυνση σας δεν δημοσιεύεται.

ΑΚΟΛΟΥΘΗΣΤΕ ΤΟ ILIOUPOLINEWS

ΑΜΕΣΗ ΕΝΗΜΕΡΩΣΗ ΚΑΙ ΜΕΣΩ ΤΩΝ ΚΟΙΝΩΝΙΚΩΝ ΔΙΚΤΥΩΝ